INTRODUCTION
RemoteRestMap is a Perl module that queries RestrictionMapper and parses the resulting reports. Using RemoteRestMap, you can write Perl scripts to analyze multiple sequences and compare the results, faster than by hand.
DOWNLOAD
Download RemoteRestMap here
INSTALLATION
Unix/Linux/OS X:
perl Makefile.PLmakemake testmake installWindows:
Pretty much the same as above, except unzip the zip file and use nmake instead of make. If you don't have nmake, copy RemoteRestMap.pm, the RemoteRestMap folder and test.pl into perl\site\lib and run test.pl from there.
REQUIREMENTS
RemoteRestMap requires the LWP::UserAgent (ver. 2.0 and up) and HTML::TreeBuilder (ver. 3.0 and up) modules. You also need Perl 5.6.0 or higher.
USAGE
Start by creating a new RemoteRestMap object. The constructor needs a URL for sitefind3.pl and a DNA sequence.
use RemoteRestMap;
my $url = 'www.restrictionmapper.org/sitefind3.pl';
my $dna = 'aacgagcctttaaggcgcttaaatcaagattccattaggcc';
my $request = RemoteRestMap->new($url, $dna);
$request->url($new_url);
$request->sequence($new_sequence);
Now you can use the get_map method to get a restriction map
of your sequence. get_map takes an optional reference to a hash
of selection parameters.
my %settings = (
DNAtype => "circular",
first => "site_length",
second => "frequency",
third => "name",
enzymetype => "NEB",
maxcuts => "all",
minlength => 6,
isoschizomers => "yes",
overhang => ["five_prime", "blunt"],
enzymelist => ['BamHI', 'EcoRI']
);
my $restriction_map = $request->get_map(\%settings); #returns map object
Note that the selection parameters are the same as on the front page of RestrictionMapper. Each
parameter is optional; the RestrictionMapper defaults will be applied for
missing ones.
Parameters are: DNAtype - "linear" or "circular". Specifies DNA conformation. Default is "linear". first - "frequency", "name", "overhang" or "site_length". Specifies column for first order sorting of output table. Default is "frequency". second - "frequency", "name", "overhang" or "site_length". Specifies column for second order sorting of output table. Default is "overhang". third - "frequency", "name", "overhang" or "site_length". Specifies column for third order sorting of output table. Default is "name". enzymetype - "NEB" or "all". Specifies whether all commercial enzymes or only New England Biolabs supplied enzymes will be returned. Default is "all". maxcuts - "all", "0", "1", "2", "3", "4", "5", "10", "20", "30" or "40". Specifies maximum number of cuts per enzyme to return. Enzymes that cut the sequence more than this number will not appear in the table. Be sure to use string notation, even for numeric values (sorry about that). Use "0" to return noncutters only. Default is "all". minlength - 4, 5, 6, 7 or 8. Specifies the minimum length of the recognition site. Enzymes with sites shorter than this number will not appear in the output. Use numeric notation. Default is 5. isoschizomers - "yes" or "no". Specifies whether to include isoschizomers. Default is "no" (prototypes only). overhang - An array reference containing any combination of "five_prime", "three_prime" and "blunt". Specifies which overhangs to include. Default is all three. enzymelist - An array reference containing a list of enzymes. Note that this list overides all other selection criteria (overhang, minlength etc.). Specifies exactly which enzymes to return. Default is no list.If you want a virtual digest instead of a map use the
get_digest method. get_digest takes only the
DNAtype and enzymelist parameters (see above). Note that the enzymelist
parameter is required.
my %settings = (DNAtype => 'circular', enzymelist => ['BamHI', 'EcoRI']);
my $digest = $request->get_digest(\%settings);
Both get_digest and get_map return result tables
as objects. The map object methods are as follows:
get_next_enz - returns the next row in the table as a hash reference or 0 when done. The keys
are NAME, SITE, OVERHANG, LENGTH, CUTNUMBER and CUTLIST. These contain
respectively the enzyme name, a DNA "regexp" representing the enzyme's
recognition sequence, the type of overhang the enzyme produces (five_prime,
three_prime or blunt), the length of the recognition sequence, the number of
times the enzyme cuts the sequence, and a reference to an array of cut positions.
while (my $cuts = $restriction_map->get_next_enz) {
my $enz = $cuts->{NAME}; # Name of the enzyme
my $recognition_site = $cuts->{SITE}; # A DNA "regexp" of the enzyme's recognition site
my $site_length = $cuts->{LENGTH}; # Number of unique bases in site (doesn't include gaps).
my $number_of_cuts = $cuts->{CUTNUMBER}; # Number of recognition sites in the sequence
my $overhang_type = $cuts->{OVERHANG}; # 'five_prime', 'three_prime' or 'blunt'
my @cut_locations = @{$cuts->{CUTLIST}}; # reference to a list of cut locations
}
tab_file - returns the entire results table in tab delimited text format.
my $table = $restriction_map->tab_file;
enzyme_list - returns an alphabetical list of enzymes that cut the sequence. DO NOT use this method if
you need to preserve the original name order, instead, populate your array one entry at
a time using get_next_enz.
my @enzymes = $restriction_map->enzyme_list;
cuts - returns a unique, ordered list of cut positions. Note that this method will eliminate duplicate cuts
produced by different enzymes.
my @cuts = $restriction_map->cuts;
enz_number - returns the number of enzymes that cut your sequence.
my $total = $restriction_map->total;
noncutters - returns a list of names of enzymes that do not cut the sequence. Note that these enzymes are
subject to the same selection criteria as the cutters.
my @noncutters = $restriction_map->noncutters;
The digest object methods are as follows:
get_next_fragment - returns the next row in the fragments table as a hash reference or 0 when finished.
The keys are:
SEQUENCE - holds the DNA sequence of the fragment.
LENGTH - the length of the sequence in bases.
FIVEPRIME - the name of the enzyme that made the 5' cut.
STARTPOS - the position of the 5' cut in the original sequence.
THREEPRIME - the name of the enzyme that made the 3' cut.
ENDPOS - the position of the 3' cut in the original sequence.
while (my $fragment = $virtual_digest->get_next_fragment) { #returns reference to hash of fragment info }
tab_file - same as above
NOTES
overhang => ['blunt'].my $map = RemoteRestMap::Map->new($html_report);
tab_file method is useful if you need to export
your table to a spread sheet.Please contact webmaster@restrictionmapper.org with questions or bug reports.